ID: 1049983367

View in Genome Browser
Species Human (GRCh38)
Location 9:925137-925159
Sequence TACGAAGCTGACCCTCCGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 40}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049983367_1049983375 25 Left 1049983367 9:925137-925159 CCACACGGAGGGTCAGCTTCGTA 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1049983375 9:925185-925207 AGTGTTCTCAGATGGCTCCCGGG No data
1049983367_1049983376 29 Left 1049983367 9:925137-925159 CCACACGGAGGGTCAGCTTCGTA 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1049983376 9:925189-925211 TTCTCAGATGGCTCCCGGGATGG No data
1049983367_1049983373 17 Left 1049983367 9:925137-925159 CCACACGGAGGGTCAGCTTCGTA 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1049983373 9:925177-925199 CATCGTGCAGTGTTCTCAGATGG No data
1049983367_1049983374 24 Left 1049983367 9:925137-925159 CCACACGGAGGGTCAGCTTCGTA 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1049983374 9:925184-925206 CAGTGTTCTCAGATGGCTCCCGG No data
1049983367_1049983369 -6 Left 1049983367 9:925137-925159 CCACACGGAGGGTCAGCTTCGTA 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1049983369 9:925154-925176 TTCGTACTCCTCCAGGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049983367 Original CRISPR TACGAAGCTGACCCTCCGTG TGG (reversed) Intronic
901703270 1:11056679-11056701 CTCGAAGCTGACCCTACATGTGG - Exonic
1071770295 10:88721901-88721923 TTCGAAGCTTACTCTCAGTGAGG + Intergenic
1076614383 10:131746464-131746486 TACGAAGCTGAACATTCCTGAGG - Intergenic
1078062546 11:8057304-8057326 TAAGCAGCTGACCCTCGGTTTGG - Intronic
1090958676 11:131536769-131536791 TAAGAAGGTGATCATCCGTGAGG + Intronic
1094828245 12:34288188-34288210 TACCCAGCTGACCCTGAGTGGGG + Intergenic
1105788970 13:23778967-23778989 TACAAAGCTGAAGCTCTGTGTGG - Intronic
1119207407 14:72804997-72805019 TAGGAAGCTGAAGCTCCGAGAGG - Intronic
1122366720 14:101198732-101198754 TCACAAGCTGACTCTCCGTGGGG - Intergenic
1122887191 14:104715346-104715368 TACGCAGCCGGCGCTCCGTGGGG + Intronic
1132338438 15:101063459-101063481 TGAGAAGCTGCCCCTCAGTGGGG + Intronic
1146968616 17:37054229-37054251 GACAAAGCAGACCCTCCCTGGGG - Intronic
1147121568 17:38338160-38338182 AAGGAAGCTGCTCCTCCGTGGGG - Intronic
1159749837 18:72286560-72286582 TAGGAAACTGACCCTCCCTCAGG - Intergenic
1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG + Exonic
1165183883 19:34000087-34000109 TAGGTAGCTGAGCCTCTGTGGGG - Intergenic
1168287293 19:55341068-55341090 GACGAGGCTGGCCCTCCGTCCGG + Intronic
927496754 2:23556280-23556302 TACGAAGATGACCCCCCTCGCGG + Intronic
931401812 2:61938238-61938260 CAGGAAGCTGCTCCTCCGTGGGG - Intronic
940293729 2:152101289-152101311 TAGGAAGCTGACCCTCCAACTGG - Intergenic
948864076 2:240766592-240766614 TAGGGAGCTGAGCCTCCTTGAGG - Intronic
1179076792 21:38129690-38129712 TAGGAAGCTGAGGCTCTGTGGGG + Intronic
1184599386 22:45533494-45533516 GAAGATGCTGCCCCTCCGTGGGG + Intronic
961017555 3:123479492-123479514 TGGGCAGCTGGCCCTCCGTGGGG - Intergenic
966734988 3:183181013-183181035 TACTCAGCTGACCCTCGGTCTGG - Intronic
970365533 4:15354407-15354429 GACGAAGCTGACCATGTGTGGGG + Intronic
992386283 5:76287679-76287701 TACAAAGCTGATTCTCCATGGGG + Intronic
1002468708 5:179421936-179421958 TAAGAAGCAGAGCCTGCGTGGGG + Intergenic
1004371790 6:15059143-15059165 TATAAAGGAGACCCTCCGTGGGG - Intergenic
1013192153 6:107812623-107812645 AAAAAGGCTGACCCTCCGTGGGG + Intronic
1014632295 6:123803020-123803042 TACGGAGCCGACCCTGCTTGGGG - Intergenic
1014873566 6:126627555-126627577 TAGGAAGCTGATCTTCCATGAGG + Intergenic
1022895776 7:34749153-34749175 AACAAAGCTGAGCCTCTGTGTGG + Intronic
1024228008 7:47342967-47342989 TGTGAAGTTGACCCTCCCTGGGG + Intronic
1026249850 7:68659893-68659915 AAGGAAGCTGAACCTCTGTGAGG - Intergenic
1026357014 7:69566699-69566721 TAAGAAACTGACCATCAGTGTGG + Intergenic
1045630855 8:104119731-104119753 TACCAGGCTGACGCTCCGTGAGG + Intronic
1046221759 8:111226177-111226199 TACGAAGCAGACACTTCCTGTGG + Intergenic
1049342382 8:142120109-142120131 TAGGAAGCTCAGCCTCCCTGAGG - Intergenic
1049983367 9:925137-925159 TACGAAGCTGACCCTCCGTGTGG - Intronic
1052790096 9:32867345-32867367 AAAGAAGCTGAACCTCGGTGGGG + Intergenic
1196153870 X:112405994-112406016 AACTCAGCTGACCCTCCATGTGG + Intergenic