ID: 1049983619

View in Genome Browser
Species Human (GRCh38)
Location 9:927680-927702
Sequence CAGGTTCCAAATGCGCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049983615_1049983619 12 Left 1049983615 9:927645-927667 CCCGTATACACGGGGTATACAAT 0: 1
1: 0
2: 0
3: 1
4: 44
Right 1049983619 9:927680-927702 CAGGTTCCAAATGCGCTTCCTGG No data
1049983613_1049983619 20 Left 1049983613 9:927637-927659 CCATCTTGCCCGTATACACGGGG 0: 1
1: 0
2: 0
3: 0
4: 15
Right 1049983619 9:927680-927702 CAGGTTCCAAATGCGCTTCCTGG No data
1049983611_1049983619 21 Left 1049983611 9:927636-927658 CCCATCTTGCCCGTATACACGGG 0: 1
1: 0
2: 0
3: 0
4: 19
Right 1049983619 9:927680-927702 CAGGTTCCAAATGCGCTTCCTGG No data
1049983616_1049983619 11 Left 1049983616 9:927646-927668 CCGTATACACGGGGTATACAATA 0: 1
1: 0
2: 0
3: 1
4: 47
Right 1049983619 9:927680-927702 CAGGTTCCAAATGCGCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049983619 Original CRISPR CAGGTTCCAAATGCGCTTCC TGG Intronic
No off target data available for this crispr