ID: 1049988528

View in Genome Browser
Species Human (GRCh38)
Location 9:972672-972694
Sequence GACTCACGCCCTCCTACTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049988519_1049988528 19 Left 1049988519 9:972630-972652 CCTTCCAGGACGGTGTGGGGAAG No data
Right 1049988528 9:972672-972694 GACTCACGCCCTCCTACTACTGG No data
1049988521_1049988528 15 Left 1049988521 9:972634-972656 CCAGGACGGTGTGGGGAAGCGGC No data
Right 1049988528 9:972672-972694 GACTCACGCCCTCCTACTACTGG No data
1049988518_1049988528 20 Left 1049988518 9:972629-972651 CCCTTCCAGGACGGTGTGGGGAA No data
Right 1049988528 9:972672-972694 GACTCACGCCCTCCTACTACTGG No data
1049988523_1049988528 -7 Left 1049988523 9:972656-972678 CCGACGTCCCCAGCCGGACTCAC No data
Right 1049988528 9:972672-972694 GACTCACGCCCTCCTACTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049988528 Original CRISPR GACTCACGCCCTCCTACTAC TGG Intergenic
No off target data available for this crispr