ID: 1049989881

View in Genome Browser
Species Human (GRCh38)
Location 9:980876-980898
Sequence GTCCGAGGACACTCCCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 83}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049989881_1049989883 -9 Left 1049989881 9:980876-980898 CCTCCAGGGGAGTGTCCTCGGAC 0: 1
1: 0
2: 3
3: 12
4: 83
Right 1049989883 9:980890-980912 TCCTCGGACACCTTAGACTGTGG No data
1049989881_1049989886 15 Left 1049989881 9:980876-980898 CCTCCAGGGGAGTGTCCTCGGAC 0: 1
1: 0
2: 3
3: 12
4: 83
Right 1049989886 9:980914-980936 GCGATGAGAAGAAAGATCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049989881 Original CRISPR GTCCGAGGACACTCCCCTGG AGG (reversed) Intronic
901796440 1:11681959-11681981 GACCGAGTCCACGCCCCTGGGGG - Exonic
902376341 1:16031761-16031783 GGCCAAGGACACGCCGCTGGAGG + Exonic
902821905 1:18948597-18948619 GTGGGAGGACACTCCCCTCGTGG + Intronic
904253050 1:29237995-29238017 CTCCCGGGACACTCCCTTGGTGG + Intronic
904367301 1:30022441-30022463 GTGGGAAGACACCCCCCTGGGGG - Intergenic
906534419 1:46543830-46543852 GTCCGTGGACACTCCCCTGCGGG + Intergenic
914250821 1:145919894-145919916 GTCCTAGGTCACTCACCTGGGGG - Intergenic
916479114 1:165199377-165199399 TTCCCAGAACCCTCCCCTGGAGG + Intergenic
919877325 1:201879412-201879434 GGCCAAGGACACAGCCCTGGGGG - Exonic
922757170 1:228102883-228102905 GTCCGCGGACACTCACAGGGCGG + Exonic
1069634491 10:69917147-69917169 CTCTGAGGACCCTGCCCTGGTGG - Intronic
1076644310 10:131941806-131941828 GTCTGAGGACACTCCTCCTGAGG - Intronic
1077542979 11:3156185-3156207 GGCCGAGGGCACTCTCCCGGGGG - Intronic
1077615237 11:3669406-3669428 GTCTGTGCACACTCCCCTGCAGG + Intronic
1083272617 11:61580048-61580070 CTCCCAGGCCACTCCCCTGGCGG + Intronic
1084779872 11:71400999-71401021 GTCCTGGGCCTCTCCCCTGGTGG - Intergenic
1084891141 11:72237705-72237727 GTCCGAGGGCAGTCCCCGGGGGG - Exonic
1088739089 11:112752169-112752191 GTCCGTGGTCCCTCCCTTGGCGG + Intergenic
1092247885 12:6873441-6873463 CTCCGAGGCCACGCCCCTGTGGG + Intronic
1092756207 12:11765907-11765929 GTCCTGGGACAGTCCCGTGGTGG + Intronic
1117075574 14:52100135-52100157 GTCCGAGGAGACACCTCTGTAGG + Intergenic
1121547380 14:94771816-94771838 GTCCGAGGGCACTACTGTGGCGG + Intergenic
1128322749 15:66704205-66704227 GTCTGAGGCGCCTCCCCTGGTGG - Intronic
1129462027 15:75704396-75704418 GTCTGAGTACCCACCCCTGGAGG + Intronic
1129722830 15:77887450-77887472 GTCTGAGTACCCACCCCTGGAGG - Intergenic
1129885299 15:79032865-79032887 GGCCTAGGACACTCCCCAAGAGG + Intronic
1132244277 15:100281817-100281839 GGGACAGGACACTCCCCTGGGGG + Intronic
1135585773 16:23669757-23669779 TTCTGAGGATACTCCACTGGGGG + Exonic
1138334258 16:56240184-56240206 ATGAGAGGACACTTCCCTGGAGG - Intronic
1139595471 16:67955222-67955244 AGCCGTGGACACTCACCTGGTGG - Intronic
1139853542 16:69964269-69964291 GTGCGATGACACTCCGCCGGTGG - Exonic
1139882515 16:70187178-70187200 GTGCGATGACACTCCGCCGGTGG - Exonic
1140369994 16:74408326-74408348 GTGCGATGACACTCCGCCGGTGG + Intronic
1142194483 16:88733149-88733171 GATGGAGGACTCTCCCCTGGGGG - Intronic
1142476722 17:193321-193343 CTCCTATCACACTCCCCTGGAGG + Intergenic
1143598310 17:7928854-7928876 ACCCAAGGACACTCCACTGGAGG + Intronic
1146624242 17:34423941-34423963 GTCAGAGCACACCACCCTGGGGG - Intergenic
1147317899 17:39629556-39629578 GCCCCAGGAAACTCACCTGGTGG - Exonic
1147720327 17:42536122-42536144 GTACCAGGATACTCCCTTGGGGG - Intergenic
1148219468 17:45851497-45851519 GTTCGAGGACAGCCTCCTGGGGG + Intergenic
1151990190 17:77569860-77569882 GTCCGAGGTTACTCCCAAGGAGG - Intergenic
1152579872 17:81161125-81161147 GTCCCAGGACACACATCTGGGGG - Intronic
1152598994 17:81252150-81252172 GTCGGAAGACACTCCCCTCTTGG - Intronic
1161129078 19:2577507-2577529 GTGGGAAGACACTCCCCTGCTGG - Intronic
1162757263 19:12867745-12867767 GTCCGAGGCCAGTTTCCTGGAGG + Exonic
1164736525 19:30545318-30545340 GTCTTACCACACTCCCCTGGTGG + Intronic
927639681 2:24838674-24838696 GTCCGTGGACTGTCCCCTGGGGG - Intronic
932217837 2:69978267-69978289 CCCCAAGGAGACTCCCCTGGAGG - Intergenic
933853733 2:86393682-86393704 GTCCTAGGCAACTCCCCTTGAGG + Intergenic
933997203 2:87678878-87678900 GTCCAAGGCCACACCACTGGTGG - Intergenic
936296648 2:111272032-111272054 GTCCAAGGCCACACCACTGGTGG + Intergenic
940041792 2:149369056-149369078 GTCCGCATACTCTCCCCTGGTGG - Intronic
946307744 2:218865745-218865767 GGCCCAGGACAGTCTCCTGGGGG + Intronic
1169207719 20:3749501-3749523 GTCCGCGGAGAATCCCCTGGAGG - Intronic
1171414038 20:24965522-24965544 GTGCCAGGCCACTCCCCTGCAGG - Intronic
1176088030 20:63306918-63306940 GGGTGGGGACACTCCCCTGGGGG - Intronic
1176200416 20:63857906-63857928 ATCCCAGTACACACCCCTGGGGG - Intergenic
1179932918 21:44582747-44582769 GTCCGTGGAAACTGCCATGGTGG - Intronic
1181274973 22:21682520-21682542 GGCAGGGGACACTCACCTGGAGG - Exonic
1184340813 22:43884994-43885016 GTCCTAGGACACTCGGCAGGTGG - Intronic
1184401847 22:44279035-44279057 GTCCGAGGACACACAGCAGGTGG + Intronic
1184697398 22:46147693-46147715 CTCAGAGGCCACTGCCCTGGCGG + Intergenic
1185330563 22:50250411-50250433 GTCCGGGGACACGCACCGGGTGG + Exonic
953023678 3:39132407-39132429 GTTTGAGGCCACACCCCTGGGGG - Intronic
953719368 3:45341871-45341893 GCCCCAGGTCACTGCCCTGGAGG + Intergenic
954200783 3:49021992-49022014 GACTGAGGACACTCGCCTGCTGG + Exonic
954983950 3:54772924-54772946 GTCTGTGTAAACTCCCCTGGAGG - Intronic
958074559 3:88658602-88658624 GTCCGTGGGCACTCACCTGGAGG + Intergenic
961437269 3:126928005-126928027 TCCTGAGGACACTGCCCTGGGGG + Intronic
965310092 3:167116443-167116465 GTCCGACCACACTCCCCGGCTGG + Intergenic
968210174 3:196842345-196842367 GTCCAAGAACCCTCTCCTGGGGG - Intergenic
968886965 4:3340294-3340316 GTCCCATGGCAGTCCCCTGGGGG + Intronic
970011873 4:11468212-11468234 GTCCGGAGACACACCCCTGGAGG - Intergenic
972256266 4:37358976-37358998 TTCCCAGGACACTCCCATAGTGG - Intronic
985640192 5:1059972-1059994 GTCAGAGGGCACTGCCCTTGGGG + Intronic
985642343 5:1069509-1069531 GTCCGAGGTCCCTCCCATGCGGG - Intronic
990032523 5:51278829-51278851 GTCTGAGGACACTCCTGAGGAGG - Intergenic
998332932 5:141345506-141345528 GACCGAGGACACTCTCCAGGGGG + Exonic
998519835 5:142790249-142790271 GTCCGAGAACACTTCTCTGAGGG + Intronic
1003021609 6:2514653-2514675 ATCCGAGGGCAGTCCACTGGGGG - Intergenic
1006439482 6:34045114-34045136 GACCTAGGTGACTCCCCTGGCGG + Intronic
1012209857 6:96506364-96506386 GTACTAGGAGATTCCCCTGGTGG + Intergenic
1019011738 6:168848476-168848498 GTCCAAGGTCAGTCCCCTGAAGG - Intergenic
1019432853 7:1007424-1007446 GGCTGAGGACACTCCCCTGTGGG + Intronic
1020905697 7:14061633-14061655 GTCCTAGGAAACTTCTCTGGAGG + Intergenic
1022106503 7:27200761-27200783 GTCCCAGGACATTCCACTGGAGG + Intergenic
1029560612 7:101300290-101300312 GCCTGAGGACAGTCCGCTGGCGG + Intergenic
1029562023 7:101308986-101309008 GCCTGAGGACAGTCCACTGGCGG + Intergenic
1048461212 8:134623298-134623320 ATCCCTGGACACTCCCCTGTGGG + Intronic
1049641506 8:143718070-143718092 GGCCCAGGCCACTCACCTGGAGG - Exonic
1049989881 9:980876-980898 GTCCGAGGACACTCCCCTGGAGG - Intronic
1057129280 9:92641981-92642003 GGCCAAGGACTCTCTCCTGGGGG + Intronic
1057842282 9:98495736-98495758 GTCTGAGCACTCTCCCCAGGTGG + Intronic
1192203403 X:69081320-69081342 GTCCCAGGAGGCTTCCCTGGGGG - Intergenic
1197262716 X:124334426-124334448 GCCCCAGGACACTCCCCTGGGGG + Intronic
1197262765 X:124334612-124334634 GCCCCAGGACACTCCCCTGGGGG + Intronic
1197262813 X:124334798-124334820 GCCCCAGGGCACTCCCCTGGGGG + Intronic
1197840507 X:130741251-130741273 GTCTGAGGAGACTGCCCTGTGGG + Intronic
1198533416 X:137566131-137566153 GTCCAAGGACATTACTCTGGAGG + Exonic