ID: 1049991410

View in Genome Browser
Species Human (GRCh38)
Location 9:995122-995144
Sequence TGTTGACCAACTTAACAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049991410_1049991414 24 Left 1049991410 9:995122-995144 CCAGGCTGTTAAGTTGGTCAACA No data
Right 1049991414 9:995169-995191 TCAAATGTATAAAAAGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049991410 Original CRISPR TGTTGACCAACTTAACAGCC TGG (reversed) Intergenic
No off target data available for this crispr