ID: 1049991414

View in Genome Browser
Species Human (GRCh38)
Location 9:995169-995191
Sequence TCAAATGTATAAAAAGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049991410_1049991414 24 Left 1049991410 9:995122-995144 CCAGGCTGTTAAGTTGGTCAACA No data
Right 1049991414 9:995169-995191 TCAAATGTATAAAAAGAAACAGG No data
1049991412_1049991414 -3 Left 1049991412 9:995149-995171 CCTAAGAGCCGAAGAACATTTCA No data
Right 1049991414 9:995169-995191 TCAAATGTATAAAAAGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049991414 Original CRISPR TCAAATGTATAAAAAGAAAC AGG Intergenic
No off target data available for this crispr