ID: 1049992325

View in Genome Browser
Species Human (GRCh38)
Location 9:1001698-1001720
Sequence GCTTACATGTGACCTGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049992320_1049992325 0 Left 1049992320 9:1001675-1001697 CCTGGAGACTTGCTCCTTATAAG No data
Right 1049992325 9:1001698-1001720 GCTTACATGTGACCTGGGACAGG No data
1049992318_1049992325 14 Left 1049992318 9:1001661-1001683 CCCTCGACGTCTGACCTGGAGAC No data
Right 1049992325 9:1001698-1001720 GCTTACATGTGACCTGGGACAGG No data
1049992316_1049992325 19 Left 1049992316 9:1001656-1001678 CCTCACCCTCGACGTCTGACCTG No data
Right 1049992325 9:1001698-1001720 GCTTACATGTGACCTGGGACAGG No data
1049992315_1049992325 20 Left 1049992315 9:1001655-1001677 CCCTCACCCTCGACGTCTGACCT No data
Right 1049992325 9:1001698-1001720 GCTTACATGTGACCTGGGACAGG No data
1049992314_1049992325 21 Left 1049992314 9:1001654-1001676 CCCCTCACCCTCGACGTCTGACC No data
Right 1049992325 9:1001698-1001720 GCTTACATGTGACCTGGGACAGG No data
1049992319_1049992325 13 Left 1049992319 9:1001662-1001684 CCTCGACGTCTGACCTGGAGACT No data
Right 1049992325 9:1001698-1001720 GCTTACATGTGACCTGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049992325 Original CRISPR GCTTACATGTGACCTGGGAC AGG Intergenic
No off target data available for this crispr