ID: 1049998028

View in Genome Browser
Species Human (GRCh38)
Location 9:1049736-1049758
Sequence TAACCTTCACCGAGCCCGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049998028_1049998031 8 Left 1049998028 9:1049736-1049758 CCACACGGGCTCGGTGAAGGTTA No data
Right 1049998031 9:1049767-1049789 CTATTTGGCACTTCGAGAATAGG No data
1049998028_1049998032 11 Left 1049998028 9:1049736-1049758 CCACACGGGCTCGGTGAAGGTTA No data
Right 1049998032 9:1049770-1049792 TTTGGCACTTCGAGAATAGGTGG No data
1049998028_1049998030 -7 Left 1049998028 9:1049736-1049758 CCACACGGGCTCGGTGAAGGTTA No data
Right 1049998030 9:1049752-1049774 AAGGTTAATGAGGAGCTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049998028 Original CRISPR TAACCTTCACCGAGCCCGTG TGG (reversed) Intergenic
No off target data available for this crispr