ID: 1050010425

View in Genome Browser
Species Human (GRCh38)
Location 9:1180316-1180338
Sequence AAGGAGAAGAGGAAGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050010425_1050010434 29 Left 1050010425 9:1180316-1180338 CCTTCCTGCTTCCTCTTCTCCTT No data
Right 1050010434 9:1180368-1180390 GAAAAGACTTTCTGAAGGTGAGG No data
1050010425_1050010435 30 Left 1050010425 9:1180316-1180338 CCTTCCTGCTTCCTCTTCTCCTT No data
Right 1050010435 9:1180369-1180391 AAAAGACTTTCTGAAGGTGAGGG No data
1050010425_1050010433 24 Left 1050010425 9:1180316-1180338 CCTTCCTGCTTCCTCTTCTCCTT No data
Right 1050010433 9:1180363-1180385 AGAAGGAAAAGACTTTCTGAAGG No data
1050010425_1050010431 7 Left 1050010425 9:1180316-1180338 CCTTCCTGCTTCCTCTTCTCCTT No data
Right 1050010431 9:1180346-1180368 ATGTTCTGTTGCTATCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050010425 Original CRISPR AAGGAGAAGAGGAAGCAGGA AGG (reversed) Intergenic
No off target data available for this crispr