ID: 1050014182

View in Genome Browser
Species Human (GRCh38)
Location 9:1216326-1216348
Sequence AGGGAAACCAAGGCATGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050014182_1050014184 -9 Left 1050014182 9:1216326-1216348 CCATCACATGCCTTGGTTTCCCT No data
Right 1050014184 9:1216340-1216362 GGTTTCCCTGTCAATCTGCACGG No data
1050014182_1050014187 10 Left 1050014182 9:1216326-1216348 CCATCACATGCCTTGGTTTCCCT No data
Right 1050014187 9:1216359-1216381 ACGGCATACCCAGACACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050014182 Original CRISPR AGGGAAACCAAGGCATGTGA TGG (reversed) Intergenic
No off target data available for this crispr