ID: 1050014956

View in Genome Browser
Species Human (GRCh38)
Location 9:1223786-1223808
Sequence TGTAATCCTAGCACTTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 867302
Summary {0: 22138, 1: 313177, 2: 258607, 3: 141974, 4: 131406}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050014956_1050014966 28 Left 1050014956 9:1223786-1223808 CCTCCCAAAGTGCTAGGATTACA 0: 22138
1: 313177
2: 258607
3: 141974
4: 131406
Right 1050014966 9:1223837-1223859 AAGCCTTCTTAACCCAACCAAGG No data
1050014956_1050014967 29 Left 1050014956 9:1223786-1223808 CCTCCCAAAGTGCTAGGATTACA 0: 22138
1: 313177
2: 258607
3: 141974
4: 131406
Right 1050014967 9:1223838-1223860 AGCCTTCTTAACCCAACCAAGGG No data
1050014956_1050014960 -2 Left 1050014956 9:1223786-1223808 CCTCCCAAAGTGCTAGGATTACA 0: 22138
1: 313177
2: 258607
3: 141974
4: 131406
Right 1050014960 9:1223807-1223829 CAGGCATAAGCCACCGCGCCTGG 0: 347
1: 9425
2: 62004
3: 130721
4: 187591

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050014956 Original CRISPR TGTAATCCTAGCACTTTGGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr