ID: 1050014958

View in Genome Browser
Species Human (GRCh38)
Location 9:1223789-1223811
Sequence GCCTGTAATCCTAGCACTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 841947
Summary {0: 15701, 1: 240057, 2: 272945, 3: 174764, 4: 138480}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050014958_1050014967 26 Left 1050014958 9:1223789-1223811 CCCAAAGTGCTAGGATTACAGGC 0: 15701
1: 240057
2: 272945
3: 174764
4: 138480
Right 1050014967 9:1223838-1223860 AGCCTTCTTAACCCAACCAAGGG No data
1050014958_1050014966 25 Left 1050014958 9:1223789-1223811 CCCAAAGTGCTAGGATTACAGGC 0: 15701
1: 240057
2: 272945
3: 174764
4: 138480
Right 1050014966 9:1223837-1223859 AAGCCTTCTTAACCCAACCAAGG No data
1050014958_1050014960 -5 Left 1050014958 9:1223789-1223811 CCCAAAGTGCTAGGATTACAGGC 0: 15701
1: 240057
2: 272945
3: 174764
4: 138480
Right 1050014960 9:1223807-1223829 CAGGCATAAGCCACCGCGCCTGG 0: 347
1: 9425
2: 62004
3: 130721
4: 187591

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050014958 Original CRISPR GCCTGTAATCCTAGCACTTT GGG (reversed) Intergenic
Too many off-targets to display for this crispr