ID: 1050014959

View in Genome Browser
Species Human (GRCh38)
Location 9:1223790-1223812
Sequence TGCCTGTAATCCTAGCACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 805511
Summary {0: 7892, 1: 107752, 2: 241468, 3: 240344, 4: 208055}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050014959_1050014967 25 Left 1050014959 9:1223790-1223812 CCAAAGTGCTAGGATTACAGGCA 0: 7892
1: 107752
2: 241468
3: 240344
4: 208055
Right 1050014967 9:1223838-1223860 AGCCTTCTTAACCCAACCAAGGG No data
1050014959_1050014966 24 Left 1050014959 9:1223790-1223812 CCAAAGTGCTAGGATTACAGGCA 0: 7892
1: 107752
2: 241468
3: 240344
4: 208055
Right 1050014966 9:1223837-1223859 AAGCCTTCTTAACCCAACCAAGG No data
1050014959_1050014960 -6 Left 1050014959 9:1223790-1223812 CCAAAGTGCTAGGATTACAGGCA 0: 7892
1: 107752
2: 241468
3: 240344
4: 208055
Right 1050014960 9:1223807-1223829 CAGGCATAAGCCACCGCGCCTGG 0: 347
1: 9425
2: 62004
3: 130721
4: 187591

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050014959 Original CRISPR TGCCTGTAATCCTAGCACTT TGG (reversed) Intergenic
Too many off-targets to display for this crispr