ID: 1050014961

View in Genome Browser
Species Human (GRCh38)
Location 9:1223817-1223839
Sequence CTTTTTTGGGCCAGGCGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050014961_1050014967 -2 Left 1050014961 9:1223817-1223839 CCACCGCGCCTGGCCCAAAAAAG No data
Right 1050014967 9:1223838-1223860 AGCCTTCTTAACCCAACCAAGGG No data
1050014961_1050014972 20 Left 1050014961 9:1223817-1223839 CCACCGCGCCTGGCCCAAAAAAG No data
Right 1050014972 9:1223860-1223882 GCCACTATGAAAGCTTAGATCGG No data
1050014961_1050014975 27 Left 1050014961 9:1223817-1223839 CCACCGCGCCTGGCCCAAAAAAG No data
Right 1050014975 9:1223867-1223889 TGAAAGCTTAGATCGGAAGGAGG No data
1050014961_1050014966 -3 Left 1050014961 9:1223817-1223839 CCACCGCGCCTGGCCCAAAAAAG No data
Right 1050014966 9:1223837-1223859 AAGCCTTCTTAACCCAACCAAGG No data
1050014961_1050014974 24 Left 1050014961 9:1223817-1223839 CCACCGCGCCTGGCCCAAAAAAG No data
Right 1050014974 9:1223864-1223886 CTATGAAAGCTTAGATCGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050014961 Original CRISPR CTTTTTTGGGCCAGGCGCGG TGG (reversed) Intergenic
No off target data available for this crispr