ID: 1050014966

View in Genome Browser
Species Human (GRCh38)
Location 9:1223837-1223859
Sequence AAGCCTTCTTAACCCAACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050014959_1050014966 24 Left 1050014959 9:1223790-1223812 CCAAAGTGCTAGGATTACAGGCA 0: 7892
1: 107752
2: 241468
3: 240344
4: 208055
Right 1050014966 9:1223837-1223859 AAGCCTTCTTAACCCAACCAAGG No data
1050014956_1050014966 28 Left 1050014956 9:1223786-1223808 CCTCCCAAAGTGCTAGGATTACA 0: 22138
1: 313177
2: 258607
3: 141974
4: 131406
Right 1050014966 9:1223837-1223859 AAGCCTTCTTAACCCAACCAAGG No data
1050014961_1050014966 -3 Left 1050014961 9:1223817-1223839 CCACCGCGCCTGGCCCAAAAAAG No data
Right 1050014966 9:1223837-1223859 AAGCCTTCTTAACCCAACCAAGG No data
1050014958_1050014966 25 Left 1050014958 9:1223789-1223811 CCCAAAGTGCTAGGATTACAGGC 0: 15701
1: 240057
2: 272945
3: 174764
4: 138480
Right 1050014966 9:1223837-1223859 AAGCCTTCTTAACCCAACCAAGG No data
1050014962_1050014966 -6 Left 1050014962 9:1223820-1223842 CCGCGCCTGGCCCAAAAAAGCCT No data
Right 1050014966 9:1223837-1223859 AAGCCTTCTTAACCCAACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050014966 Original CRISPR AAGCCTTCTTAACCCAACCA AGG Intergenic
No off target data available for this crispr