ID: 1050017716 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:1252650-1252672 |
| Sequence | AAATTCCACAATACCACATG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1050017716_1050017720 | -7 | Left | 1050017716 | 9:1252650-1252672 | CCCCATGTGGTATTGTGGAATTT | No data | ||
| Right | 1050017720 | 9:1252666-1252688 | GGAATTTATGCTAGGCTTGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1050017716 | Original CRISPR | AAATTCCACAATACCACATG GGG (reversed) | Intergenic | ||