ID: 1050017716

View in Genome Browser
Species Human (GRCh38)
Location 9:1252650-1252672
Sequence AAATTCCACAATACCACATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050017716_1050017720 -7 Left 1050017716 9:1252650-1252672 CCCCATGTGGTATTGTGGAATTT No data
Right 1050017720 9:1252666-1252688 GGAATTTATGCTAGGCTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050017716 Original CRISPR AAATTCCACAATACCACATG GGG (reversed) Intergenic