ID: 1050017718

View in Genome Browser
Species Human (GRCh38)
Location 9:1252652-1252674
Sequence ATAAATTCCACAATACCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050017718_1050017720 -9 Left 1050017718 9:1252652-1252674 CCATGTGGTATTGTGGAATTTAT No data
Right 1050017720 9:1252666-1252688 GGAATTTATGCTAGGCTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050017718 Original CRISPR ATAAATTCCACAATACCACA TGG (reversed) Intergenic