ID: 1050017720

View in Genome Browser
Species Human (GRCh38)
Location 9:1252666-1252688
Sequence GGAATTTATGCTAGGCTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050017717_1050017720 -8 Left 1050017717 9:1252651-1252673 CCCATGTGGTATTGTGGAATTTA No data
Right 1050017720 9:1252666-1252688 GGAATTTATGCTAGGCTTGTTGG No data
1050017718_1050017720 -9 Left 1050017718 9:1252652-1252674 CCATGTGGTATTGTGGAATTTAT No data
Right 1050017720 9:1252666-1252688 GGAATTTATGCTAGGCTTGTTGG No data
1050017716_1050017720 -7 Left 1050017716 9:1252650-1252672 CCCCATGTGGTATTGTGGAATTT No data
Right 1050017720 9:1252666-1252688 GGAATTTATGCTAGGCTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050017720 Original CRISPR GGAATTTATGCTAGGCTTGT TGG Intergenic