ID: 1050026268

View in Genome Browser
Species Human (GRCh38)
Location 9:1337429-1337451
Sequence GCCAAAAATATCTCCAGACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050026268_1050026269 -4 Left 1050026268 9:1337429-1337451 CCGTGTCTGGAGATATTTTTGGC No data
Right 1050026269 9:1337448-1337470 TGGCTATCACAACTGTGTAGAGG No data
1050026268_1050026272 18 Left 1050026268 9:1337429-1337451 CCGTGTCTGGAGATATTTTTGGC No data
Right 1050026272 9:1337470-1337492 GTGTGCTACTGGCATCTAGTGGG 0: 14
1: 173
2: 515
3: 1016
4: 1479
1050026268_1050026271 17 Left 1050026268 9:1337429-1337451 CCGTGTCTGGAGATATTTTTGGC No data
Right 1050026271 9:1337469-1337491 GGTGTGCTACTGGCATCTAGTGG No data
1050026268_1050026273 24 Left 1050026268 9:1337429-1337451 CCGTGTCTGGAGATATTTTTGGC No data
Right 1050026273 9:1337476-1337498 TACTGGCATCTAGTGGGTAAAGG 0: 9
1: 220
2: 629
3: 1106
4: 1466
1050026268_1050026270 7 Left 1050026268 9:1337429-1337451 CCGTGTCTGGAGATATTTTTGGC No data
Right 1050026270 9:1337459-1337481 ACTGTGTAGAGGTGTGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050026268 Original CRISPR GCCAAAAATATCTCCAGACA CGG (reversed) Intergenic
No off target data available for this crispr