ID: 1050029602

View in Genome Browser
Species Human (GRCh38)
Location 9:1371695-1371717
Sequence ACCTTGGGACATCAGCTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050029599_1050029602 -3 Left 1050029599 9:1371675-1371697 CCAGGATGGCAGGAAGGAAAACC No data
Right 1050029602 9:1371695-1371717 ACCTTGGGACATCAGCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050029602 Original CRISPR ACCTTGGGACATCAGCTCTG TGG Intergenic
No off target data available for this crispr