ID: 1050032846

View in Genome Browser
Species Human (GRCh38)
Location 9:1404588-1404610
Sequence GCCACCTGCCAAAAAGTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050032846_1050032847 12 Left 1050032846 9:1404588-1404610 CCACAGACTTTTTGGCAGGTGGC No data
Right 1050032847 9:1404623-1404645 CATTTATTCCCTTGCCAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050032846 Original CRISPR GCCACCTGCCAAAAAGTCTG TGG (reversed) Intergenic
No off target data available for this crispr