ID: 1050033675

View in Genome Browser
Species Human (GRCh38)
Location 9:1412872-1412894
Sequence CGGGAGGGATGGTGGGAGAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050033667_1050033675 10 Left 1050033667 9:1412839-1412861 CCTTGAAAATGGCTTCTGGCTTG No data
Right 1050033675 9:1412872-1412894 CGGGAGGGATGGTGGGAGATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050033675 Original CRISPR CGGGAGGGATGGTGGGAGAT CGG Intergenic
No off target data available for this crispr