ID: 1050039207

View in Genome Browser
Species Human (GRCh38)
Location 9:1471096-1471118
Sequence CTGTGTATATAAATGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050039201_1050039207 5 Left 1050039201 9:1471068-1471090 CCCACATCAGCTTTTGCCCAGGA No data
Right 1050039207 9:1471096-1471118 CTGTGTATATAAATGGAGCTGGG No data
1050039199_1050039207 13 Left 1050039199 9:1471060-1471082 CCTATGTTCCCACATCAGCTTTT No data
Right 1050039207 9:1471096-1471118 CTGTGTATATAAATGGAGCTGGG No data
1050039202_1050039207 4 Left 1050039202 9:1471069-1471091 CCACATCAGCTTTTGCCCAGGAA No data
Right 1050039207 9:1471096-1471118 CTGTGTATATAAATGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050039207 Original CRISPR CTGTGTATATAAATGGAGCT GGG Intergenic
No off target data available for this crispr