ID: 1050042073

View in Genome Browser
Species Human (GRCh38)
Location 9:1506567-1506589
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050042073_1050042076 -7 Left 1050042073 9:1506567-1506589 CCCTTAAAGCCTAGATTGCTGCA No data
Right 1050042076 9:1506583-1506605 TGCTGCAGAGCTCTTTTTCTTGG No data
1050042073_1050042078 21 Left 1050042073 9:1506567-1506589 CCCTTAAAGCCTAGATTGCTGCA No data
Right 1050042078 9:1506611-1506633 GTGTGTGCACGTGTGTGGTGTGG No data
1050042073_1050042077 16 Left 1050042073 9:1506567-1506589 CCCTTAAAGCCTAGATTGCTGCA No data
Right 1050042077 9:1506606-1506628 TGAATGTGTGTGCACGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050042073 Original CRISPR TGCAGCAATCTAGGCTTTAA GGG (reversed) Intergenic