ID: 1050042074

View in Genome Browser
Species Human (GRCh38)
Location 9:1506568-1506590
Sequence CTGCAGCAATCTAGGCTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050042074_1050042077 15 Left 1050042074 9:1506568-1506590 CCTTAAAGCCTAGATTGCTGCAG No data
Right 1050042077 9:1506606-1506628 TGAATGTGTGTGCACGTGTGTGG No data
1050042074_1050042076 -8 Left 1050042074 9:1506568-1506590 CCTTAAAGCCTAGATTGCTGCAG No data
Right 1050042076 9:1506583-1506605 TGCTGCAGAGCTCTTTTTCTTGG No data
1050042074_1050042078 20 Left 1050042074 9:1506568-1506590 CCTTAAAGCCTAGATTGCTGCAG No data
Right 1050042078 9:1506611-1506633 GTGTGTGCACGTGTGTGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050042074 Original CRISPR CTGCAGCAATCTAGGCTTTA AGG (reversed) Intergenic