ID: 1050042075

View in Genome Browser
Species Human (GRCh38)
Location 9:1506576-1506598
Sequence AAAGAGCTCTGCAGCAATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050042075_1050042078 12 Left 1050042075 9:1506576-1506598 CCTAGATTGCTGCAGAGCTCTTT No data
Right 1050042078 9:1506611-1506633 GTGTGTGCACGTGTGTGGTGTGG No data
1050042075_1050042077 7 Left 1050042075 9:1506576-1506598 CCTAGATTGCTGCAGAGCTCTTT No data
Right 1050042077 9:1506606-1506628 TGAATGTGTGTGCACGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050042075 Original CRISPR AAAGAGCTCTGCAGCAATCT AGG (reversed) Intergenic
No off target data available for this crispr