ID: 1050042076

View in Genome Browser
Species Human (GRCh38)
Location 9:1506583-1506605
Sequence TGCTGCAGAGCTCTTTTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050042074_1050042076 -8 Left 1050042074 9:1506568-1506590 CCTTAAAGCCTAGATTGCTGCAG No data
Right 1050042076 9:1506583-1506605 TGCTGCAGAGCTCTTTTTCTTGG No data
1050042073_1050042076 -7 Left 1050042073 9:1506567-1506589 CCCTTAAAGCCTAGATTGCTGCA No data
Right 1050042076 9:1506583-1506605 TGCTGCAGAGCTCTTTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050042076 Original CRISPR TGCTGCAGAGCTCTTTTTCT TGG Intergenic