ID: 1050042078

View in Genome Browser
Species Human (GRCh38)
Location 9:1506611-1506633
Sequence GTGTGTGCACGTGTGTGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050042073_1050042078 21 Left 1050042073 9:1506567-1506589 CCCTTAAAGCCTAGATTGCTGCA No data
Right 1050042078 9:1506611-1506633 GTGTGTGCACGTGTGTGGTGTGG No data
1050042075_1050042078 12 Left 1050042075 9:1506576-1506598 CCTAGATTGCTGCAGAGCTCTTT No data
Right 1050042078 9:1506611-1506633 GTGTGTGCACGTGTGTGGTGTGG No data
1050042074_1050042078 20 Left 1050042074 9:1506568-1506590 CCTTAAAGCCTAGATTGCTGCAG No data
Right 1050042078 9:1506611-1506633 GTGTGTGCACGTGTGTGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050042078 Original CRISPR GTGTGTGCACGTGTGTGGTG TGG Intergenic
No off target data available for this crispr