ID: 1050046990

View in Genome Browser
Species Human (GRCh38)
Location 9:1557211-1557233
Sequence AACATACCTTTTTTTTTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050046990_1050046993 8 Left 1050046990 9:1557211-1557233 CCTCAAAAAAAAAAAGGTATGTT No data
Right 1050046993 9:1557242-1557264 AATCCTTGGTACACAGACTGTGG No data
1050046990_1050046991 -6 Left 1050046990 9:1557211-1557233 CCTCAAAAAAAAAAAGGTATGTT No data
Right 1050046991 9:1557228-1557250 TATGTTGAGATCCTAATCCTTGG No data
1050046990_1050046996 25 Left 1050046990 9:1557211-1557233 CCTCAAAAAAAAAAAGGTATGTT No data
Right 1050046996 9:1557259-1557281 CTGTGGCTTTGTTTGGAAATAGG No data
1050046990_1050046995 18 Left 1050046990 9:1557211-1557233 CCTCAAAAAAAAAAAGGTATGTT No data
Right 1050046995 9:1557252-1557274 ACACAGACTGTGGCTTTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050046990 Original CRISPR AACATACCTTTTTTTTTTTG AGG (reversed) Intergenic
No off target data available for this crispr