ID: 1050046991

View in Genome Browser
Species Human (GRCh38)
Location 9:1557228-1557250
Sequence TATGTTGAGATCCTAATCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050046989_1050046991 -5 Left 1050046989 9:1557210-1557232 CCCTCAAAAAAAAAAAGGTATGT No data
Right 1050046991 9:1557228-1557250 TATGTTGAGATCCTAATCCTTGG No data
1050046990_1050046991 -6 Left 1050046990 9:1557211-1557233 CCTCAAAAAAAAAAAGGTATGTT No data
Right 1050046991 9:1557228-1557250 TATGTTGAGATCCTAATCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050046991 Original CRISPR TATGTTGAGATCCTAATCCT TGG Intergenic
No off target data available for this crispr