ID: 1050046994

View in Genome Browser
Species Human (GRCh38)
Location 9:1557245-1557267
Sequence AAGCCACAGTCTGTGTACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050046994_1050046996 -9 Left 1050046994 9:1557245-1557267 CCTTGGTACACAGACTGTGGCTT No data
Right 1050046996 9:1557259-1557281 CTGTGGCTTTGTTTGGAAATAGG No data
1050046994_1050046997 22 Left 1050046994 9:1557245-1557267 CCTTGGTACACAGACTGTGGCTT No data
Right 1050046997 9:1557290-1557312 AGAAATGATTAGTTAAGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050046994 Original CRISPR AAGCCACAGTCTGTGTACCA AGG (reversed) Intergenic
No off target data available for this crispr