ID: 1050046996

View in Genome Browser
Species Human (GRCh38)
Location 9:1557259-1557281
Sequence CTGTGGCTTTGTTTGGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050046990_1050046996 25 Left 1050046990 9:1557211-1557233 CCTCAAAAAAAAAAAGGTATGTT No data
Right 1050046996 9:1557259-1557281 CTGTGGCTTTGTTTGGAAATAGG No data
1050046989_1050046996 26 Left 1050046989 9:1557210-1557232 CCCTCAAAAAAAAAAAGGTATGT No data
Right 1050046996 9:1557259-1557281 CTGTGGCTTTGTTTGGAAATAGG No data
1050046994_1050046996 -9 Left 1050046994 9:1557245-1557267 CCTTGGTACACAGACTGTGGCTT No data
Right 1050046996 9:1557259-1557281 CTGTGGCTTTGTTTGGAAATAGG No data
1050046992_1050046996 -3 Left 1050046992 9:1557239-1557261 CCTAATCCTTGGTACACAGACTG No data
Right 1050046996 9:1557259-1557281 CTGTGGCTTTGTTTGGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050046996 Original CRISPR CTGTGGCTTTGTTTGGAAAT AGG Intergenic
No off target data available for this crispr