ID: 1050048643

View in Genome Browser
Species Human (GRCh38)
Location 9:1575537-1575559
Sequence TTGGTACTATAGTCCTCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050048632_1050048643 21 Left 1050048632 9:1575493-1575515 CCAGAAGTTCTGAGCAGGCCAGA No data
Right 1050048643 9:1575537-1575559 TTGGTACTATAGTCCTCAGGTGG No data
1050048629_1050048643 26 Left 1050048629 9:1575488-1575510 CCCATCCAGAAGTTCTGAGCAGG No data
Right 1050048643 9:1575537-1575559 TTGGTACTATAGTCCTCAGGTGG No data
1050048631_1050048643 25 Left 1050048631 9:1575489-1575511 CCATCCAGAAGTTCTGAGCAGGC No data
Right 1050048643 9:1575537-1575559 TTGGTACTATAGTCCTCAGGTGG No data
1050048638_1050048643 3 Left 1050048638 9:1575511-1575533 CCAGATGGTAGGGTCCATGGGTA No data
Right 1050048643 9:1575537-1575559 TTGGTACTATAGTCCTCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050048643 Original CRISPR TTGGTACTATAGTCCTCAGG TGG Intergenic
No off target data available for this crispr