ID: 1050051575

View in Genome Browser
Species Human (GRCh38)
Location 9:1607651-1607673
Sequence CAGCTCCGATATCCTTACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050051569_1050051575 22 Left 1050051569 9:1607606-1607628 CCAACTCTTGGTATTCTTTGGTT No data
Right 1050051575 9:1607651-1607673 CAGCTCCGATATCCTTACACTGG No data
1050051570_1050051575 -1 Left 1050051570 9:1607629-1607651 CCAGAGCCCTCCCTTTGCAAAGC No data
Right 1050051575 9:1607651-1607673 CAGCTCCGATATCCTTACACTGG No data
1050051572_1050051575 -8 Left 1050051572 9:1607636-1607658 CCTCCCTTTGCAAAGCAGCTCCG No data
Right 1050051575 9:1607651-1607673 CAGCTCCGATATCCTTACACTGG No data
1050051571_1050051575 -7 Left 1050051571 9:1607635-1607657 CCCTCCCTTTGCAAAGCAGCTCC No data
Right 1050051575 9:1607651-1607673 CAGCTCCGATATCCTTACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050051575 Original CRISPR CAGCTCCGATATCCTTACAC TGG Intergenic
No off target data available for this crispr