ID: 1050052662

View in Genome Browser
Species Human (GRCh38)
Location 9:1619460-1619482
Sequence CAGTTCCACATGGAGTTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050052658_1050052662 -9 Left 1050052658 9:1619446-1619468 CCCTTTCTGAGCCTCAGTTCCAC No data
Right 1050052662 9:1619460-1619482 CAGTTCCACATGGAGTTGTGAGG No data
1050052659_1050052662 -10 Left 1050052659 9:1619447-1619469 CCTTTCTGAGCCTCAGTTCCACA No data
Right 1050052662 9:1619460-1619482 CAGTTCCACATGGAGTTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050052662 Original CRISPR CAGTTCCACATGGAGTTGTG AGG Intergenic
No off target data available for this crispr