ID: 1050057221

View in Genome Browser
Species Human (GRCh38)
Location 9:1668219-1668241
Sequence CTGAGTATCTACTCTGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050057221_1050057222 6 Left 1050057221 9:1668219-1668241 CCTGACACAGAGTAGATACTCAG No data
Right 1050057222 9:1668248-1668270 TTCGAAGAATTTAACTACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050057221 Original CRISPR CTGAGTATCTACTCTGTGTC AGG (reversed) Intergenic
No off target data available for this crispr