ID: 1050057440

View in Genome Browser
Species Human (GRCh38)
Location 9:1670519-1670541
Sequence CCCAACAAGCAGGAGCTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050057436_1050057440 -4 Left 1050057436 9:1670500-1670522 CCAAAATTGGCCTGTGGGTCCCA No data
Right 1050057440 9:1670519-1670541 CCCAACAAGCAGGAGCTTGAAGG No data
1050057432_1050057440 13 Left 1050057432 9:1670483-1670505 CCAGCTTGGGAGATGTGCCAAAA No data
Right 1050057440 9:1670519-1670541 CCCAACAAGCAGGAGCTTGAAGG No data
1050057430_1050057440 24 Left 1050057430 9:1670472-1670494 CCCAAGGGGCACCAGCTTGGGAG No data
Right 1050057440 9:1670519-1670541 CCCAACAAGCAGGAGCTTGAAGG No data
1050057431_1050057440 23 Left 1050057431 9:1670473-1670495 CCAAGGGGCACCAGCTTGGGAGA No data
Right 1050057440 9:1670519-1670541 CCCAACAAGCAGGAGCTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050057440 Original CRISPR CCCAACAAGCAGGAGCTTGA AGG Intergenic
No off target data available for this crispr