ID: 1050058010

View in Genome Browser
Species Human (GRCh38)
Location 9:1676059-1676081
Sequence CAGAAGGATGACATTGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050058008_1050058010 -2 Left 1050058008 9:1676038-1676060 CCAGGCATGTCATTGTCATAGCA No data
Right 1050058010 9:1676059-1676081 CAGAAGGATGACATTGCAGCTGG No data
1050058007_1050058010 7 Left 1050058007 9:1676029-1676051 CCTTAAGATCCAGGCATGTCATT No data
Right 1050058010 9:1676059-1676081 CAGAAGGATGACATTGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050058010 Original CRISPR CAGAAGGATGACATTGCAGC TGG Intergenic
No off target data available for this crispr