ID: 1050058193

View in Genome Browser
Species Human (GRCh38)
Location 9:1677760-1677782
Sequence TGGTCAAAGCTGAAAGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050058193_1050058197 12 Left 1050058193 9:1677760-1677782 CCATCCACTTTCAGCTTTGACCA No data
Right 1050058197 9:1677795-1677817 ACCCATTCATTTGTATTTCATGG No data
1050058193_1050058199 13 Left 1050058193 9:1677760-1677782 CCATCCACTTTCAGCTTTGACCA No data
Right 1050058199 9:1677796-1677818 CCCATTCATTTGTATTTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050058193 Original CRISPR TGGTCAAAGCTGAAAGTGGA TGG (reversed) Intergenic
No off target data available for this crispr