ID: 1050062412

View in Genome Browser
Species Human (GRCh38)
Location 9:1723572-1723594
Sequence GCAACCTGCCTGGCTTCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050062401_1050062412 29 Left 1050062401 9:1723520-1723542 CCCAGTGATAAACTTTTAAGGAA No data
Right 1050062412 9:1723572-1723594 GCAACCTGCCTGGCTTCAACAGG No data
1050062402_1050062412 28 Left 1050062402 9:1723521-1723543 CCAGTGATAAACTTTTAAGGAAG No data
Right 1050062412 9:1723572-1723594 GCAACCTGCCTGGCTTCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050062412 Original CRISPR GCAACCTGCCTGGCTTCAAC AGG Intergenic
No off target data available for this crispr