ID: 1050062721

View in Genome Browser
Species Human (GRCh38)
Location 9:1727291-1727313
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050062716_1050062721 -1 Left 1050062716 9:1727269-1727291 CCAGAGGAGATTCACTGGGTAAC No data
Right 1050062721 9:1727291-1727313 CAGGGTGCACAATGGGCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050062721 Original CRISPR CAGGGTGCACAATGGGCTCA AGG Intergenic
No off target data available for this crispr