ID: 1050063931

View in Genome Browser
Species Human (GRCh38)
Location 9:1738850-1738872
Sequence CCTAATTTGGAGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050063931_1050063939 5 Left 1050063931 9:1738850-1738872 CCCTCCTCCTTCTCCAAATTAGG No data
Right 1050063939 9:1738878-1738900 TCTTCAGAGCCTCTCCTGCCTGG No data
1050063931_1050063942 21 Left 1050063931 9:1738850-1738872 CCCTCCTCCTTCTCCAAATTAGG No data
Right 1050063942 9:1738894-1738916 TGCCTGGCATGTAACAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050063931 Original CRISPR CCTAATTTGGAGAAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr