ID: 1050064250

View in Genome Browser
Species Human (GRCh38)
Location 9:1742198-1742220
Sequence CTGAAGCTAAAGATGCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050064250_1050064252 1 Left 1050064250 9:1742198-1742220 CCCAGCTGCATCTTTAGCTTCAG No data
Right 1050064252 9:1742222-1742244 TTTAATCAGAAAAAAAAAAAAGG No data
1050064250_1050064253 23 Left 1050064250 9:1742198-1742220 CCCAGCTGCATCTTTAGCTTCAG No data
Right 1050064253 9:1742244-1742266 GTTAAAATTTCAAAACTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050064250 Original CRISPR CTGAAGCTAAAGATGCAGCT GGG (reversed) Intergenic
No off target data available for this crispr