ID: 1050064406

View in Genome Browser
Species Human (GRCh38)
Location 9:1743742-1743764
Sequence AACCTTGAACAACTAGTAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050064405_1050064406 3 Left 1050064405 9:1743716-1743738 CCTAATTAAAGTCACAATACTTG No data
Right 1050064406 9:1743742-1743764 AACCTTGAACAACTAGTAATTGG No data
1050064404_1050064406 4 Left 1050064404 9:1743715-1743737 CCCTAATTAAAGTCACAATACTT No data
Right 1050064406 9:1743742-1743764 AACCTTGAACAACTAGTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050064406 Original CRISPR AACCTTGAACAACTAGTAAT TGG Intergenic
No off target data available for this crispr