ID: 1050067470

View in Genome Browser
Species Human (GRCh38)
Location 9:1775495-1775517
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050067468_1050067470 -10 Left 1050067468 9:1775482-1775504 CCTCAGATTCCTGGACTCCTAGA No data
Right 1050067470 9:1775495-1775517 GACTCCTAGAAACCTCACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050067470 Original CRISPR GACTCCTAGAAACCTCACTG AGG Intergenic
No off target data available for this crispr