ID: 1050067598

View in Genome Browser
Species Human (GRCh38)
Location 9:1777001-1777023
Sequence TGGCAACCAGCAGTGGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050067598_1050067602 -1 Left 1050067598 9:1777001-1777023 CCATCTCCCACTGCTGGTTGCCA No data
Right 1050067602 9:1777023-1777045 ATGATCCGCCATTGAAATCAAGG No data
1050067598_1050067606 13 Left 1050067598 9:1777001-1777023 CCATCTCCCACTGCTGGTTGCCA No data
Right 1050067606 9:1777037-1777059 AAATCAAGGAGCCTTTTTCAGGG No data
1050067598_1050067605 12 Left 1050067598 9:1777001-1777023 CCATCTCCCACTGCTGGTTGCCA No data
Right 1050067605 9:1777036-1777058 GAAATCAAGGAGCCTTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050067598 Original CRISPR TGGCAACCAGCAGTGGGAGA TGG (reversed) Intergenic
No off target data available for this crispr