ID: 1050077964

View in Genome Browser
Species Human (GRCh38)
Location 9:1884378-1884400
Sequence GTATGAGCCAACGTTGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050077956_1050077964 24 Left 1050077956 9:1884331-1884353 CCAGGGTGAGGGGCATGGGGAGT No data
Right 1050077964 9:1884378-1884400 GTATGAGCCAACGTTGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050077964 Original CRISPR GTATGAGCCAACGTTGAGCT GGG Intergenic
No off target data available for this crispr