ID: 1050086173

View in Genome Browser
Species Human (GRCh38)
Location 9:1968091-1968113
Sequence GCTATTCAACACCACGACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050086168_1050086173 26 Left 1050086168 9:1968042-1968064 CCAAACAGTAAATATTTATAGTG No data
Right 1050086173 9:1968091-1968113 GCTATTCAACACCACGACTGTGG No data
1050086171_1050086173 -4 Left 1050086171 9:1968072-1968094 CCATATGGTCTCTGCCGCAGCTA No data
Right 1050086173 9:1968091-1968113 GCTATTCAACACCACGACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050086173 Original CRISPR GCTATTCAACACCACGACTG TGG Intergenic
No off target data available for this crispr