ID: 1050088678

View in Genome Browser
Species Human (GRCh38)
Location 9:1993411-1993433
Sequence CGGGATAAAGGGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050088678_1050088688 30 Left 1050088678 9:1993411-1993433 CCTTCCTCCTTCCCTTTATCCCG No data
Right 1050088688 9:1993464-1993486 CAAAGCATGGTATATTCCATAGG No data
1050088678_1050088687 17 Left 1050088678 9:1993411-1993433 CCTTCCTCCTTCCCTTTATCCCG No data
Right 1050088687 9:1993451-1993473 TATCTATGTTGTACAAAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050088678 Original CRISPR CGGGATAAAGGGAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr