ID: 1050091742

View in Genome Browser
Species Human (GRCh38)
Location 9:2022042-2022064
Sequence CAACTGGAACTTCTTGCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 366}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050091742_1050091747 4 Left 1050091742 9:2022042-2022064 CCTGGAGCAAGAAGTTCCAGTTG 0: 1
1: 0
2: 0
3: 10
4: 366
Right 1050091747 9:2022069-2022091 GAATTTTCAGAAGATAAAGTCGG 0: 1
1: 0
2: 3
3: 37
4: 595
1050091742_1050091748 13 Left 1050091742 9:2022042-2022064 CCTGGAGCAAGAAGTTCCAGTTG 0: 1
1: 0
2: 0
3: 10
4: 366
Right 1050091748 9:2022078-2022100 GAAGATAAAGTCGGAGATTGTGG 0: 1
1: 0
2: 4
3: 58
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050091742 Original CRISPR CAACTGGAACTTCTTGCTCC AGG (reversed) Intronic
900697769 1:4022902-4022924 AAAGTGGAACTTCATGCTGCTGG + Intergenic
902249813 1:15146910-15146932 CAGATGGGACTTCTTGATCCAGG - Intergenic
903149511 1:21396149-21396171 CCACTGCAACTTCTGCCTCCCGG - Intergenic
903431067 1:23300375-23300397 TAACTGCAACTTCTGCCTCCTGG - Intergenic
905115239 1:35633144-35633166 CCACTGCAACTTCCAGCTCCTGG - Intronic
905540732 1:38758296-38758318 CAACTGCAACCTCTGCCTCCTGG - Intergenic
905815583 1:40948416-40948438 CCACTGCAACTTCTGCCTCCCGG - Intergenic
906021061 1:42630047-42630069 TAACTGCAACCTCTAGCTCCCGG + Intronic
907560387 1:55382323-55382345 CAACTGGGACTACTTGCTGTAGG + Intergenic
908540803 1:65120385-65120407 TCACTGCAACTTCTTCCTCCCGG + Intergenic
910193039 1:84613639-84613661 TCACTGCAACTTCTGGCTCCTGG - Intergenic
911681938 1:100726864-100726886 AAACTGTAAATTCCTGCTCCGGG + Intronic
911737926 1:101357932-101357954 CCACTGCAACTTCTGCCTCCCGG + Intergenic
912407860 1:109456575-109456597 TAACTGCAACTTCTGCCTCCTGG + Intergenic
912515749 1:110215627-110215649 CCACAGGAACTCCCTGCTCCAGG + Intronic
912994120 1:114516482-114516504 TAACTGCAACCTCTGGCTCCTGG + Intergenic
913648667 1:120887945-120887967 TCACTGCAACTTCTTCCTCCTGG - Intergenic
914078029 1:144375417-144375439 TCACTGCAACTTCTTCCTCCTGG + Intergenic
914101150 1:144591084-144591106 TCACTGCAACTTCTTCCTCCTGG - Intergenic
914172938 1:145243951-145243973 TCACTGCAACTTCTTCCTCCTGG + Intergenic
914297826 1:146346568-146346590 TCACTGCAACTTCTTCCTCCTGG + Intergenic
914638802 1:149581973-149581995 TCACTGCAACTTCTTCCTCCTGG - Intergenic
915332895 1:155124704-155124726 CAACTGGAAATGCTGCCTCCAGG + Intergenic
915459330 1:156060491-156060513 CCACTGGAACCTCTGCCTCCCGG + Intergenic
916723504 1:167503085-167503107 CAACTGGAACTTCATCCTGCTGG + Intronic
918155673 1:181843826-181843848 CCACTGCAACCTCTGGCTCCTGG - Intergenic
918583061 1:186154739-186154761 CAACTGTCATTTCTTGTTCCTGG + Intronic
920130493 1:203728320-203728342 CAATTGTAACTACTTTCTCCTGG + Intronic
923405448 1:233654840-233654862 CAAGTGGAACCTGTTGCTCAAGG + Intronic
924288669 1:242514314-242514336 CAACTGGCAGCTCTTCCTCCAGG + Intronic
924359810 1:243226912-243226934 TAACTGCAACTTCTGCCTCCCGG - Intronic
924703133 1:246474442-246474464 CCACTGCAACTTCTGCCTCCCGG - Intronic
1064238972 10:13607485-13607507 TAACTGCAACCTCTAGCTCCTGG + Intronic
1069190642 10:65483986-65484008 CCACTGCAACTTCTGTCTCCTGG + Intergenic
1070249548 10:74762087-74762109 CACCTGCAACCTCTGGCTCCTGG - Intergenic
1070403144 10:76070957-76070979 CAGCTGCACCTTCATGCTCCTGG - Intronic
1072065359 10:91864170-91864192 AAACAGGTGCTTCTTGCTCCTGG + Exonic
1072237843 10:93468607-93468629 CAACTGGAAATTCTTGGCCTGGG - Intronic
1072876711 10:99180813-99180835 TCACTGCAACTTCTGGCTCCCGG - Intronic
1073373843 10:103015776-103015798 TCACTGGAACTTCTACCTCCCGG - Intronic
1073825086 10:107311637-107311659 TCACTGGAACTTCTGCCTCCTGG - Intergenic
1074285073 10:112090379-112090401 CAGCTGGGTCTTTTTGCTCCTGG + Intergenic
1074466199 10:113683087-113683109 TAACTGCAACTTCTGCCTCCCGG + Intronic
1074968723 10:118517772-118517794 CAACTGGAGATCATTGCTCCTGG + Intergenic
1076147529 10:128136032-128136054 TCACTGAAACTTCTTCCTCCTGG - Intergenic
1078114662 11:8434140-8434162 CAACTGCAACCTCTGCCTCCTGG - Intronic
1078297862 11:10093089-10093111 TCACTGCAACTTCTTCCTCCTGG + Intronic
1078666053 11:13326126-13326148 CAACTGCAACCTCTGCCTCCCGG - Intronic
1080154482 11:29092714-29092736 CCACTGCAACTTCTGCCTCCCGG - Intergenic
1081703112 11:45164296-45164318 CAACTGGAGCCTCTGTCTCCGGG - Intronic
1081834085 11:46139573-46139595 TCACTGGAACCTCTGGCTCCTGG + Intergenic
1082025356 11:47567329-47567351 CCACTGCAACTTCTGCCTCCCGG - Intronic
1083322919 11:61858251-61858273 CAACTGCAACCTCTACCTCCTGG + Intronic
1083401959 11:62429709-62429731 CCACTGCAACTTCTGCCTCCTGG - Intergenic
1083452788 11:62757307-62757329 CAGCTGGAACTGCTTGCTTGTGG - Intergenic
1083956754 11:65988049-65988071 TCACTGGAACCTCTGGCTCCTGG - Intergenic
1085088595 11:73690614-73690636 CATCTGTAACTTCTTTTTCCAGG - Intronic
1085949151 11:81308463-81308485 TCACTGGAACTTCTGCCTCCTGG + Intergenic
1086761875 11:90641534-90641556 CAAGAGAAACTTCTTGCCCCAGG + Intergenic
1086772847 11:90790890-90790912 CATCTGTTACTTTTTGCTCCAGG + Intergenic
1089543247 11:119203862-119203884 TCACTGCAACTTCTGGCTCCTGG + Intergenic
1089575271 11:119437887-119437909 CAACTGCAACCTCTGCCTCCCGG + Intergenic
1093018344 12:14177411-14177433 TCACTGCAACTTCTTCCTCCAGG + Intergenic
1093161949 12:15757553-15757575 TCACTGCAACTTCTGGCTCCTGG - Intronic
1094302488 12:28980761-28980783 CAACTGGAACTCATTGCTGGTGG + Intergenic
1094702830 12:32886922-32886944 TAACTGCAACTTCTGTCTCCAGG - Intronic
1095437706 12:42209487-42209509 CTACTGCAACTTCTGCCTCCTGG - Intronic
1096063072 12:48718114-48718136 CCACTGCAACTTCTGCCTCCCGG - Intergenic
1097685698 12:62688919-62688941 TAACTGCAACTTCTGTCTCCTGG - Intronic
1097862354 12:64530686-64530708 CAACTGGAACTTTTTCTTACAGG - Intergenic
1099263204 12:80410216-80410238 CCACTGCAACTTCTACCTCCTGG - Intronic
1100476389 12:94939532-94939554 CACCTGGATCTTCTTTCTTCGGG - Intronic
1101087338 12:101249669-101249691 TAACTGCAACTTCTTCCTCCTGG - Intergenic
1101319853 12:103663912-103663934 CATCTGGGACCACTTGCTCCAGG + Intronic
1102104995 12:110313783-110313805 CCACTGGAACCTCTGCCTCCTGG + Intronic
1102115305 12:110398339-110398361 CCACTGCAACTTCTGTCTCCTGG - Intronic
1102138445 12:110594683-110594705 TAACTGCAACTTCTGCCTCCTGG - Intergenic
1102360131 12:112278816-112278838 CTACTGCAACTTCTGCCTCCCGG - Intronic
1102504809 12:113377276-113377298 CAACTTGAATTTCTTGCACGTGG + Intronic
1102583461 12:113907083-113907105 GAACTGGGACTTCTGGCTTCTGG + Intronic
1103103051 12:118197543-118197565 CAGTTGGATCTTTTTGCTCCAGG - Intronic
1103157158 12:118695358-118695380 TCACTGCAACTTCTTCCTCCCGG - Intergenic
1103358709 12:120341375-120341397 CATCTGTAACTTCTTTTTCCAGG - Exonic
1103714633 12:122937282-122937304 TCACTGCAACTTCTTCCTCCTGG - Intronic
1104342311 12:127961984-127962006 TAACTGAAACTTCTTGCTGTTGG - Intergenic
1105060882 12:133149430-133149452 CCACTGTAACATCTGGCTCCTGG + Intronic
1105383643 13:19910598-19910620 TCACTGGAACTTCCTCCTCCCGG + Intergenic
1105749887 13:23413050-23413072 TAACTGCAACCTCTTCCTCCCGG + Intronic
1105837588 13:24224367-24224389 CAGCTGGCACTTCCTGCCCCGGG - Exonic
1106595288 13:31130158-31130180 CCCCTGGGACTTCTTGCCCCTGG + Intergenic
1106691153 13:32118071-32118093 AAAATGGAACTTGCTGCTCCAGG + Intronic
1106693756 13:32147581-32147603 GAAGTGGAACTTGTTGATCCTGG - Intronic
1107351672 13:39520993-39521015 CAACTGGAAATGCTGGCACCAGG + Intronic
1108287890 13:48926839-48926861 ACACTGCAACTTCTTTCTCCTGG + Intergenic
1111972789 13:94934337-94934359 CAACTGCAACCTCTGCCTCCGGG - Intergenic
1111996708 13:95172842-95172864 CCACTGCAACTTCTACCTCCTGG - Intronic
1112655974 13:101452848-101452870 CTTCAGGAACTTCTTGCTGCTGG + Exonic
1113114043 13:106855724-106855746 TAACTGCAACTTCCTCCTCCCGG - Intergenic
1114527364 14:23375173-23375195 CAACTGCAACCTCTACCTCCTGG - Intronic
1115560035 14:34574573-34574595 CAACTGTAACCTCTTCCTTCTGG - Intronic
1115982794 14:39072155-39072177 TCACTGGAACTTCTGCCTCCTGG - Intronic
1116915071 14:50517224-50517246 CCACTGCAACTTCTGCCTCCTGG + Intronic
1116940204 14:50783709-50783731 TAATTGGAACTACTGGCTCCAGG - Intronic
1117826977 14:59714158-59714180 TAACTGCAACTTCTGCCTCCTGG - Intronic
1119181565 14:72608802-72608824 GACCTGGAATTTGTTGCTCCTGG + Intergenic
1119296087 14:73534302-73534324 TCACTGCAACTTCTGGCTCCCGG - Intronic
1119528803 14:75344657-75344679 CAACTGGAACTTAATCCTACTGG - Intergenic
1119862863 14:77949082-77949104 TCACTGGAACTTCTGCCTCCTGG + Intergenic
1120474402 14:84969377-84969399 CAAGAGGAAGTGCTTGCTCCAGG - Intergenic
1121064603 14:90951042-90951064 CAACTGCAACCTCTGCCTCCCGG - Intronic
1121407805 14:93729494-93729516 CAAGGTGAATTTCTTGCTCCTGG + Intronic
1122229216 14:100297030-100297052 TTACTGCAACTTCTTCCTCCTGG - Intronic
1122624498 14:103077418-103077440 CAGCTGGAAGTCCTTGCACCAGG + Intergenic
1124186010 15:27530173-27530195 CAATTGGAACAGCTTGCCCCAGG - Intronic
1125558858 15:40610822-40610844 CAGCTGCAACTTCTGCCTCCTGG + Exonic
1125725997 15:41868414-41868436 CAGCAGGCACTTCTTGCTGCAGG - Exonic
1125831426 15:42719470-42719492 CAGGTGGAACTTGGTGCTCCAGG + Exonic
1127255476 15:57288410-57288432 AAATTTGAACTTCTTGCTGCTGG - Exonic
1129607910 15:77033759-77033781 CCCCTGGAACTTCCTACTCCTGG + Intronic
1129752202 15:78073892-78073914 TAACTGCAACCTCTGGCTCCCGG - Intronic
1131017831 15:89072399-89072421 TAACTGCAACTTCTGCCTCCTGG - Intergenic
1131170148 15:90172270-90172292 CCACTGCAACTTCTGCCTCCTGG - Intronic
1133583152 16:7166086-7166108 CCACTGTAACTTCTGCCTCCGGG + Intronic
1134819862 16:17238136-17238158 TAACTGCAACTTGTTTCTCCAGG - Intronic
1135138424 16:19901730-19901752 CAACTGGAAGTTCATATTCCGGG + Intergenic
1135167072 16:20148417-20148439 CCACTGCAACTTCTGCCTCCTGG - Intergenic
1135688365 16:24516405-24516427 CTACTGCAACTTCTGCCTCCTGG + Intergenic
1136182352 16:28562399-28562421 GAACTGGACCTTCATGTTCCAGG - Intronic
1136490932 16:30607885-30607907 TCACTGTAACCTCTTGCTCCCGG - Intronic
1136573409 16:31109687-31109709 TCACTGGAAGTTCTTGCTGCAGG - Exonic
1136984360 16:35084978-35085000 CGTCTGGAACTTCTCACTCCAGG - Intergenic
1138618413 16:58191434-58191456 CAACTGCAACCTCTGCCTCCCGG + Intronic
1140151250 16:72369079-72369101 TCACTGCAACTTCTGGCTCCTGG - Intergenic
1140253927 16:73318936-73318958 CAACTGGCCCTTCTTGCTTGTGG + Intergenic
1142821263 17:2469597-2469619 CAACTGCAACCTCTGCCTCCTGG + Intronic
1143098598 17:4492059-4492081 CAACTGGAATCTCTTGCCCAGGG - Intergenic
1143486769 17:7259646-7259668 CATCTGGGTCTTCTTGGTCCAGG - Exonic
1144272866 17:13635512-13635534 TCACTGCAACTTCTTCCTCCTGG - Intergenic
1144559030 17:16306602-16306624 CAACTGCAACCTCTGCCTCCTGG + Intronic
1147755841 17:42767133-42767155 CAACTGCAACCTCTGCCTCCTGG - Intergenic
1149068871 17:52516032-52516054 CATGTTGAAGTTCTTGCTCCTGG + Intergenic
1150592108 17:66572390-66572412 TCACTGTAACCTCTTGCTCCCGG - Intronic
1150923240 17:69505366-69505388 CCACTGCAACTTCTGCCTCCTGG - Intronic
1151444185 17:74152548-74152570 CAGCAGGAACTCCTTCCTCCGGG + Intergenic
1152602146 17:81269436-81269458 CCACTGCAACTTCTGCCTCCTGG - Intronic
1155142221 18:23053874-23053896 AAACTGGAACTTCTGGCTACTGG + Intergenic
1156644729 18:39147301-39147323 TCACTGCAACTTCTTCCTCCTGG - Intergenic
1157659800 18:49430808-49430830 CCACTGCAACTTCTGCCTCCTGG - Intronic
1158349906 18:56554575-56554597 TCACTGGAACTTCTTCCCCCTGG + Intergenic
1159151264 18:64526603-64526625 CAACTGGCCCTTCTTGTACCTGG - Intergenic
1159670840 18:71218948-71218970 CAACTGTAACTTAATTCTCCAGG - Intergenic
1161529073 19:4776289-4776311 CCACTGCAACTTCTGCCTCCTGG + Intergenic
1162549777 19:11351899-11351921 CCACAGGAACTTCTTGCTGAGGG - Exonic
1162696864 19:12483610-12483632 CAACTGCAACCTCTGCCTCCCGG + Intronic
1163117774 19:15198674-15198696 TCACTGGAACCTCTGGCTCCTGG - Intronic
1163580952 19:18138389-18138411 TTACTGGAACTTCTACCTCCCGG + Intronic
1163944824 19:20525569-20525591 TAACTGCAACTTCTGCCTCCTGG + Intergenic
1164049577 19:21573061-21573083 CCACTGCAACCTCTTCCTCCCGG - Intergenic
1164096395 19:22013590-22013612 TCACTGTAACTTCTGGCTCCTGG + Intergenic
1164167745 19:22697449-22697471 TAACTGCAACTTCTGCCTCCCGG - Intergenic
1165560416 19:36674826-36674848 TCACTGCAACTTCTTCCTCCTGG + Intergenic
1166035882 19:40168166-40168188 CCACTGCAACTTCTGTCTCCCGG - Intergenic
1168573620 19:57490427-57490449 TCACTGCAACTTCTGGCTCCTGG + Intronic
1168662720 19:58180688-58180710 CAACTGCAACCTCTGCCTCCCGG - Intergenic
926031627 2:9595627-9595649 TCACTGGAACTTCTGCCTCCTGG - Intronic
928599537 2:32890420-32890442 CCACTGCAACTTCTGCCTCCTGG - Intergenic
929580205 2:43077218-43077240 TAACTGCAACTTCTGCCTCCAGG - Intergenic
930687213 2:54322839-54322861 CAACTGCAACCTCTGTCTCCCGG + Intergenic
930795522 2:55386146-55386168 CCACTGCAACCTCTGGCTCCTGG - Intronic
932338679 2:70945777-70945799 ACACTAGAACTTATTGCTCCTGG + Intronic
932730909 2:74221483-74221505 CAACTGGAAGATCTTTTTCCTGG + Exonic
933581931 2:84137162-84137184 CAAATGCAAATTCTGGCTCCAGG + Intergenic
933770775 2:85742573-85742595 CAACTGGAAATGTTTGCTCTGGG + Intergenic
934897795 2:98133546-98133568 CAAATGGTATTTCTTGGTCCTGG - Intronic
935974239 2:108561815-108561837 CAACTGCAACCTCTGCCTCCCGG + Intronic
936065027 2:109324657-109324679 CTCCTGGAACTCCTTTCTCCTGG + Intronic
937637846 2:124176917-124176939 CCACTGCAACTTCTGCCTCCTGG + Intronic
939354023 2:141077658-141077680 CAGGTGGAACTTCTTCCTCGGGG - Intronic
939538326 2:143461213-143461235 CGACTGCAACTTCTGTCTCCTGG - Intronic
939967551 2:148625288-148625310 TCACTGCAACTTCTTCCTCCTGG - Intergenic
941417707 2:165242646-165242668 CAACAGTACCTTCTTTCTCCAGG - Intronic
941596742 2:167486282-167486304 TAACTGCAACTTCTGCCTCCTGG - Intergenic
942041991 2:172075924-172075946 CTGCTGGAACTTCTGGCTCCAGG - Intronic
942600029 2:177631404-177631426 CCACTGCAACTTCTGCCTCCTGG - Intronic
944631934 2:201635685-201635707 TCACTGGAACTTCTGCCTCCCGG - Intronic
944839990 2:203615557-203615579 TCACTGCAACTTCTTCCTCCTGG - Intergenic
945337867 2:208614670-208614692 TAACTGCAACCTCTTCCTCCCGG + Intronic
945449081 2:209973151-209973173 TAACATGAAGTTCTTGCTCCTGG - Exonic
945952072 2:216048633-216048655 CCACTGGAACTTCCACCTCCTGG - Intronic
946523601 2:220493747-220493769 CATCTGGGTCTTCTGGCTCCTGG - Intergenic
946869788 2:224075131-224075153 CAAATGGAACTTGGTGCTCAAGG + Intergenic
947432457 2:230043197-230043219 CAACAGGAGCAGCTTGCTCCAGG + Intronic
947511233 2:230756041-230756063 CAGCTGGTACTGCTTTCTCCCGG - Intronic
948153286 2:235762032-235762054 TCACTGGAACTTCCGGCTCCTGG - Intronic
1169813423 20:9631600-9631622 TAACAGGATCTTCTTGCTCAAGG - Intronic
1169923420 20:10758614-10758636 CAACTGGAACTTAATCCTGCTGG - Intergenic
1170790383 20:19503939-19503961 TAACTGGCACTCCTTGGTCCTGG - Intronic
1171041620 20:21769419-21769441 CAACTAGAACCTCTATCTCCTGG + Intergenic
1171145943 20:22782794-22782816 TCACTGCAACTTCTTCCTCCTGG + Intergenic
1172270480 20:33652981-33653003 CCACTGCAACTTCTGCCTCCTGG - Intergenic
1172538672 20:35694217-35694239 CAACTGCAACCTCTGCCTCCTGG + Intronic
1172722080 20:37006763-37006785 CAACTGCAACCTCTGCCTCCCGG - Intronic
1173122819 20:40309233-40309255 TCACTGGAACTTCTGCCTCCTGG - Intergenic
1174513018 20:51069898-51069920 CAACTGTAACCTCTGCCTCCTGG + Intergenic
1175574722 20:60052329-60052351 CCACTGGACCCTCTTGCTCAAGG - Intergenic
1175811680 20:61861797-61861819 CACCTGGGACTTCTTCCTACAGG - Intronic
1175986500 20:62766535-62766557 CAAATGGTACTTATTCCTCCCGG - Intergenic
1176143833 20:63556819-63556841 GGGCTGGTACTTCTTGCTCCAGG - Intergenic
1176616394 21:9030577-9030599 CATCTGGAACCTCTTGTTACAGG - Intergenic
1177196129 21:17905400-17905422 CAGCCGTAACTTCTTTCTCCTGG - Intronic
1177364710 21:20119247-20119269 CAACTGCAACCTCTGCCTCCGGG + Intergenic
1177741937 21:25165187-25165209 TCACTGCAACTTCTTCCTCCTGG - Intergenic
1180198320 21:46210359-46210381 GAACTGGAACTGCTTGGGCCAGG - Intronic
1181567577 22:23748964-23748986 TCACTGGAACCTCTGGCTCCTGG + Intronic
1182535824 22:31002136-31002158 TAACTGCAACTTCTGCCTCCTGG - Intergenic
1183358868 22:37373141-37373163 GAACTGGACCTTCTTGCGCAGGG + Exonic
1183864504 22:40693472-40693494 CAAATAGTACTTATTGCTCCAGG - Intergenic
1185208790 22:49555085-49555107 CACCTGGAACTGCTTGGTGCCGG - Intronic
949184420 3:1172957-1172979 CTACTGGAAGATCTTTCTCCAGG + Intronic
950178227 3:10891715-10891737 CAACTGGAGGTTCTCGGTCCTGG - Intronic
950662479 3:14475104-14475126 CCACTGCAACTTCTGCCTCCTGG + Intronic
951214874 3:20014483-20014505 TCACTGCAACTTCTGGCTCCTGG + Intergenic
951462837 3:22969629-22969651 CACCTGGAACTTCATTCTTCAGG - Intergenic
951893606 3:27589323-27589345 TCACTGCAACTTCTTCCTCCTGG + Intergenic
952907196 3:38148829-38148851 CAACTGCAACCTCTGCCTCCTGG + Intergenic
952974841 3:38684904-38684926 AAACTGGAACTGCTTGGTCTTGG + Intergenic
953055621 3:39384874-39384896 CAACTGCAACCTCTGACTCCCGG + Intronic
953237855 3:41121710-41121732 CAACTGGAACTTAATCCCCCTGG + Intergenic
954194723 3:48989867-48989889 CGTCTGCATCTTCTTGCTCCAGG - Exonic
954699575 3:52444161-52444183 CAACTGGCACTTTTTGCCCAGGG - Intronic
956288622 3:67637642-67637664 CAACCTGATCTTCATGCTCCAGG + Intronic
956676756 3:71741059-71741081 CCACTGCAACTTCTGCCTCCTGG - Intronic
957473389 3:80691651-80691673 CCACTGCAACTTCTGCCTCCTGG + Intergenic
958912541 3:100010687-100010709 CCACTGCAACTTCTACCTCCCGG + Intronic
959750462 3:109828660-109828682 CAACAGGAATTTCTTGTTCCAGG - Intergenic
961771209 3:129251455-129251477 CAACTGCAACCTCTGCCTCCTGG + Intronic
962923043 3:139967730-139967752 CAACTGGAATATTTTACTCCTGG - Intronic
963114057 3:141710766-141710788 GTACAGGAACTTCCTGCTCCAGG - Intergenic
963683677 3:148411467-148411489 TCACTGGAACTTCTGCCTCCTGG + Intergenic
963802012 3:149685458-149685480 CCAGTGAAACTTCTTGCTCTGGG + Intronic
963813878 3:149808563-149808585 CCACTGAAACTTCTGCCTCCTGG + Intronic
964003286 3:151802721-151802743 TCACTGGAACTTCTGCCTCCTGG + Intergenic
964488446 3:157209475-157209497 TAACTGCAACTTCTGCCTCCTGG + Intergenic
965303632 3:167036454-167036476 TAACTGCAACCTCTTCCTCCTGG + Intergenic
968323938 3:197795765-197795787 TCACTGCAACTTCTTTCTCCTGG + Intronic
974918776 4:68210655-68210677 TCACTGGAACTTCTGCCTCCCGG + Intergenic
977019229 4:91738996-91739018 TCACTGCAACTTCTTCCTCCTGG - Intergenic
977194646 4:94044302-94044324 CTATTGGTACTTCATGCTCCAGG - Intergenic
977550589 4:98438665-98438687 ACACTGCAACTTCTTCCTCCAGG + Intronic
978166759 4:105618544-105618566 TCACTGGAACTTCTACCTCCTGG - Intronic
978856253 4:113398022-113398044 CCACTGCAACTTCTGCCTCCTGG - Intergenic
979487241 4:121283465-121283487 CCACTGGAATGTCATGCTCCAGG - Intergenic
980123282 4:128749533-128749555 TAACTGCAACTTCTGCCTCCTGG - Intergenic
980244925 4:130226373-130226395 TCACTGGAACTTCTGCCTCCTGG - Intergenic
983644995 4:169980761-169980783 CAACTGCAACCTCTGCCTCCTGG + Intergenic
983737462 4:171079828-171079850 CCACTGCAGCTTCTAGCTCCTGG - Intergenic
983957745 4:173717177-173717199 CATCTGGAATTTCTTCCTTCTGG + Intergenic
986070265 5:4276154-4276176 TAACTGCAACCTCTTACTCCCGG + Intergenic
986219759 5:5757367-5757389 CAACAGGAAGTCTTTGCTCCAGG + Intergenic
987055993 5:14192332-14192354 CCACTGCAACTTCTACCTCCTGG + Intronic
987214995 5:15726334-15726356 AATCTGGAACTCCTTGCTCCAGG - Intronic
987512145 5:18853981-18854003 TCACTGAAACTTCTTCCTCCAGG - Intergenic
987853096 5:23382477-23382499 CAAATGGTACTTCTGGCTCTAGG - Intergenic
988466395 5:31496350-31496372 TCACTGGAACTTCTGCCTCCTGG - Intronic
989765080 5:45073411-45073433 CAAGTGGGACCTCCTGCTCCAGG + Intergenic
991452682 5:66769536-66769558 CTACTGTAACCTGTTGCTCCTGG + Intronic
991478986 5:67056769-67056791 TAACTGTAACTTCTGCCTCCTGG + Intronic
994542390 5:101116508-101116530 AAACTGGTATTACTTGCTCCAGG - Intergenic
995246473 5:109940937-109940959 TCACTGGAACTTCTACCTCCTGG + Intergenic
995404249 5:111776091-111776113 CAACTGGTACATACTGCTCCTGG - Intronic
995731566 5:115248729-115248751 CATCTGGCACTTCTGACTCCAGG - Intronic
997557418 5:134812710-134812732 CAACTGCAACCTCTGCCTCCTGG + Intronic
999592819 5:153167405-153167427 CCACTGTAACTTCTGCCTCCTGG - Intergenic
1000952621 5:167502902-167502924 CAACTGCAACTTCCGTCTCCTGG + Intronic
1002168728 5:177363390-177363412 CCACTGCAACTTCTTATTCCCGG + Intronic
1002364829 5:178701818-178701840 CTACTGGAACCTCTGCCTCCCGG + Intergenic
1002507052 5:179686850-179686872 CCACTGCAACTTCCGGCTCCAGG + Intronic
1002510219 5:179710979-179711001 CAACTGCAACCTCTGCCTCCTGG - Intronic
1002518422 5:179775941-179775963 CAAGTGGAATTGCTTCCTCCGGG - Exonic
1003960890 6:11208101-11208123 TCACTGCAACTTCTGGCTCCTGG - Intronic
1004511400 6:16286829-16286851 TCACTGCAACTTCTGGCTCCCGG - Intronic
1004871926 6:19913788-19913810 CAGGTGCAACTTCTTGCTGCTGG + Intergenic
1005236791 6:23772853-23772875 CAACTGCAACCTCTGCCTCCCGG - Intergenic
1005516576 6:26560067-26560089 TAACTGCAACTTCTGCCTCCTGG - Intergenic
1005570991 6:27145576-27145598 CTACTCCAACTTCTTGCTTCGGG + Intergenic
1005772273 6:29085934-29085956 TAACTGCAACTTCTGACTCCTGG + Intergenic
1006128733 6:31855628-31855650 CCACTGTAACCTCTCGCTCCCGG + Intergenic
1006839619 6:37020323-37020345 CAAATGGAACCTATGGCTCCTGG - Intronic
1007152301 6:39705784-39705806 CAACTGGGACTTATTTCTACTGG - Intronic
1007461915 6:42025369-42025391 CAACTGCACCTCTTTGCTCCAGG - Intronic
1007469721 6:42081249-42081271 CCACTGCAACTTCTGCCTCCCGG + Exonic
1007564724 6:42840998-42841020 CCACTGCAACTTCTGCCTCCTGG - Intronic
1008241959 6:49124468-49124490 CCACTGCAACTTCTGCCTCCCGG - Intergenic
1009360737 6:62809138-62809160 CAACTGAAAATTGTTGCTCTTGG - Intergenic
1011499845 6:87975947-87975969 CCACTGCAACCTCTGGCTCCTGG + Intergenic
1011669209 6:89665963-89665985 CAACTGCAACCTCCAGCTCCCGG - Intronic
1013148337 6:107417682-107417704 CAACTGCAACCTCTGCCTCCTGG - Intronic
1013432278 6:110065818-110065840 CAACTAGGATTTCTTGCACCAGG - Intergenic
1015555643 6:134458973-134458995 CAACTGGAGCTTCTGGCAGCAGG + Intergenic
1017465584 6:154690660-154690682 TCACTGGAACTTCTGCCTCCTGG - Intergenic
1020093721 7:5356087-5356109 TCACTGCAACTTCTAGCTCCTGG - Intronic
1020230705 7:6316268-6316290 CCACTGCAACTTCTGCCTCCTGG - Intergenic
1020266984 7:6567393-6567415 TCACTGGAACTTCTGTCTCCTGG - Intergenic
1020593684 7:10176078-10176100 CAGTTGGAAGTTTTTGCTCCAGG - Intergenic
1020771149 7:12396858-12396880 CAACTGCAACTTCCATCTCCTGG - Intronic
1022612526 7:31891197-31891219 GAACTGGAACTGATTGCTCCTGG + Intronic
1023438237 7:40160301-40160323 TCACTGCAACCTCTTGCTCCCGG + Intronic
1023449565 7:40268722-40268744 CCACTGCAACTTCTGCCTCCCGG + Intronic
1024999930 7:55307336-55307358 CATCAGCAACTGCTTGCTCCTGG - Intergenic
1025259454 7:57408461-57408483 CACCTGAAACTTCTGACTCCAGG + Intergenic
1025281343 7:57628037-57628059 CACCTGGGACATCATGCTCCAGG + Intergenic
1025303386 7:57837470-57837492 CACCTGGGACATCATGCTCCAGG - Intergenic
1025729772 7:64099524-64099546 TCACTGCAACTTCTTCCTCCAGG + Intronic
1026059634 7:67014801-67014823 TCACTGCAACTTCTAGCTCCCGG + Intronic
1026172493 7:67966304-67966326 CAACAGGAATTTATTGCTCACGG - Intergenic
1026685800 7:72509210-72509232 CAACTGCAACCTCTGCCTCCTGG + Intergenic
1026718459 7:72810201-72810223 TCACTGCAACTTCTAGCTCCCGG - Intronic
1027003842 7:74674926-74674948 TCACTGCAACTTCTTCCTCCTGG + Intronic
1029255397 7:99266199-99266221 CAACTGGAGCTTAATGCTGCTGG - Intergenic
1030112034 7:106035002-106035024 CCACTGCAACTTCTGCCTCCTGG - Intergenic
1030288939 7:107853365-107853387 CCACTGCAACCTCCTGCTCCTGG + Intergenic
1030439252 7:109565779-109565801 TCACTGCAACTTCTGGCTCCTGG + Intergenic
1030810834 7:113970351-113970373 CCACTGCAACTTCCAGCTCCCGG - Intronic
1031189246 7:118525628-118525650 CAAATGGTATTTCTTGTTCCAGG + Intergenic
1031906885 7:127470088-127470110 CCACTGCAACTTCTGCCTCCTGG - Intergenic
1031969215 7:128051972-128051994 TAACTTGAACTTCTTCCTACTGG - Intronic
1034633492 7:152549063-152549085 CAACTGCAACCTCTGCCTCCCGG + Intergenic
1034640488 7:152598182-152598204 CCACTGCAACTTCTGCCTCCCGG + Intergenic
1035879360 8:3227840-3227862 TCACTGCAACTTCTAGCTCCTGG + Intronic
1037208921 8:16361635-16361657 CCACTGGAAGTTCTGCCTCCTGG + Intronic
1039728831 8:40252615-40252637 TTACTGCAACTTCTTCCTCCTGG - Intergenic
1041039748 8:53835071-53835093 CCACTGCAACTTCTGCCTCCTGG - Intronic
1043014124 8:74916931-74916953 GAACTGGCTCTTCTGGCTCCAGG + Intergenic
1045508908 8:102798278-102798300 CAACTGAAACTTCTGCCGCCCGG - Intergenic
1046965564 8:120161736-120161758 CAACTGCAACCTCTGCCTCCTGG + Intronic
1047595663 8:126375265-126375287 CAACTGTCACTTCTTCCTACTGG - Intergenic
1047756976 8:127926448-127926470 CAACTGGAGCTGCTTCATCCGGG + Intergenic
1047807427 8:128374950-128374972 CAACTGAAAATTCTTCATCCTGG - Intergenic
1049551024 8:143259794-143259816 CATCTGGAACTTCTTGCTTTGGG - Intronic
1049763334 8:144340824-144340846 TCACTGGAACTTCTGCCTCCCGG - Intergenic
1049973626 9:842032-842054 CCGCGGGGACTTCTTGCTCCCGG - Exonic
1050091742 9:2022042-2022064 CAACTGGAACTTCTTGCTCCAGG - Intronic
1050175048 9:2861139-2861161 CAACTGCAACCTCTACCTCCCGG - Intergenic
1050432222 9:5573527-5573549 CAACTGCAACCTCTGCCTCCCGG - Intergenic
1050601335 9:7255185-7255207 TCACTGCAACTTCTTCCTCCTGG + Intergenic
1052519769 9:29531518-29531540 CAACTGTTATCTCTTGCTCCAGG + Intergenic
1054843561 9:69769083-69769105 CAACTGGCATCTCATGCTCCAGG + Intergenic
1054916959 9:70503511-70503533 CTACTGGCACTTCTTGGACCCGG - Intergenic
1054944542 9:70782284-70782306 CAACTGCAACCTCTGCCTCCTGG + Intronic
1055601551 9:77924494-77924516 CAACAGGACCTTTTTTCTCCTGG + Intronic
1055775410 9:79762343-79762365 CAACTAGAACTTCTGGCTAAGGG - Intergenic
1056005616 9:82267839-82267861 TCACTGCAACTTCTTCCTCCTGG + Intergenic
1056290082 9:85134276-85134298 TCACTGGAACTTCTGCCTCCTGG - Intergenic
1057583109 9:96305197-96305219 CAACTGGATCCTCTAGCTCAAGG + Intergenic
1058129568 9:101234640-101234662 CAACTAGAAATTCCTGTTCCAGG + Intronic
1062402562 9:136378920-136378942 AACCTGGCACTTCTGGCTCCTGG - Exonic
1062424523 9:136499966-136499988 CATCTGAACCTGCTTGCTCCAGG + Intronic
1185949912 X:4421594-4421616 CAACTGCAACCTCTGCCTCCTGG - Intergenic
1186636662 X:11413055-11413077 CAACTGGAATTTCCTCCTCTGGG + Intronic
1186717704 X:12270070-12270092 CAACTGGAAATTCTTTCTGAAGG - Intronic
1186753624 X:12647341-12647363 CAACTGGAGCTTCATCCTCTTGG + Intronic
1186849604 X:13567757-13567779 CAACTGGAGGTTCATGCTGCTGG - Intergenic
1187057403 X:15753832-15753854 CACCTGGAACCTCTGCCTCCTGG - Intronic
1188300138 X:28497516-28497538 CAACTGCAACCTCTGCCTCCTGG - Intergenic
1189458237 X:41213220-41213242 TCACTGGAACTTCTAACTCCTGG - Intronic
1190235342 X:48610837-48610859 TCACTGCAACCTCTTGCTCCTGG + Intergenic
1190392002 X:49941245-49941267 CTACTGCAACTTCTGCCTCCTGG - Intronic
1190533573 X:51405525-51405547 CCACTGCAACTTCTGCCTCCCGG - Intergenic
1190643642 X:52504651-52504673 TGTCTGGAACTCCTTGCTCCAGG + Intergenic
1192533851 X:71911548-71911570 CCGCTGGAACTTCCTGCTCTTGG + Intergenic
1193562970 X:83042479-83042501 CCACTGCAACCTCTTCCTCCTGG - Intergenic
1193928989 X:87528638-87528660 CAACTGCAACCTCTGCCTCCTGG - Intronic
1196049414 X:111289284-111289306 CCACTGGTACTTCATGCTCCTGG - Intergenic
1197714913 X:129699640-129699662 TAAATGGACCTTCTTGCTCCTGG - Intergenic
1198391384 X:136178827-136178849 TCACTGCAACCTCTTGCTCCTGG + Intronic
1198509624 X:137336969-137336991 CAACTGCAACCTCTGCCTCCAGG - Intergenic
1201479344 Y:14422536-14422558 TCACTGCAACTTCTTCCTCCTGG + Intergenic